Codon chart: all 64 codons and how to read them

A codon chart, also called a codon table, shows which amino acid each of the 64 mRNA codons codes for. To read it, find the codon's first base down the left side, its second base along the top, and its third base inside that box. 61 codons code for the 20 amino acids, AUG also starts the protein, and UAA, UAG and UGA are stop codons.

The full chart is just below. To skip the lookups, paste a DNA or mRNA sequence into our DNA Translator. It transcribes the DNA, splits the mRNA into codons, builds the protein and lights up every codon it used on its own codon chart.

Try it

DNA Translator

Transcribe DNA to mRNA and translate it with a codon chart

Open the calculatorGo to its page

The codon chart (mRNA codon table)

Each cell gives a codon and the three-letter code of its amino acid. Rows are grouped by the first base, and the last column gives the third base for that row.

This is the standard genetic code, the one used by nearly all living things, which is why it is sometimes called the universal codon chart. It is written in mRNA bases, so it has U (uracil) where DNA has T (thymine). A few genomes use small variations: in vertebrate mitochondria, for example, UGA codes for tryptophan instead of stop. NCBI lists 27 genetic codes in all, but school and college biology uses the standard one.

How to read a codon chart

1. Write the mRNA in groups of three bases. Each group is a codon.
2. Find the first base of the codon in the left-hand column.
3. Move across to the column for the second base.
4. In that box, find the row for the third base. That cell gives the amino acid.

For example, take the codon CAU. The first base is C, so go to the C rows. The second base is A, so use the A column. The third base is U, so take the top row of that box: CAU codes for His, histidine. CAC, one row down, codes for histidine too.

How to read a codon wheel

A codon wheel, or circle codon chart, holds the same 64 codons in rings. Start in the centre with the first base, move out to the middle ring for the second base, then to the outer ring for the third base. The amino acid is written outside that segment. A wheel and a chart always give the same answer, so use whichever your class gives you.

Amino acid codon chart: all 20 amino acids

Turned the other way round, the chart tells you every codon for each amino acid. This is handy when a question gives you an amino acid and asks which codons could make it.

Most amino acids have more than one codon, so biologists call the genetic code degenerate (or redundant). Only methionine and tryptophan have a single codon each, while leucine, serine and arginine have six. Often only the first two bases matter: all four codons that start GC code for alanine, whatever the third base.

Start and stop codons

AUG is the start codon. It codes for methionine and also marks where translation begins, so most proteins start with methionine. In a real mRNA, the ribosome starts at the first AUG it reaches, and that AUG fixes how the rest is split into codons, which is called the reading frame.

UAA, UAG and UGA are the stop codons. They code for no amino acid: they tell the ribosome to let go of the finished chain. So a stretch of mRNA from a start codon to a stop codon with n codons in total makes a protein of n − 1 amino acids, because the stop codon adds nothing.

DNA codon chart and the DNA to mRNA converter

A DNA codon chart is the same chart with T in place of U, written for the coding strand of the DNA. The coding strand has the same sequence as the mRNA, apart from T for U. The other strand, the template strand, is the one the cell actually copies, so it is complementary to the mRNA.

So to convert DNA to mRNA by hand: from the coding strand, swap every T for U. From the template strand, pair each base using the table above. The template strand runs 3' to 5' when it is written under the mRNA, which runs 5' to 3'.

Example: template strand to protein

A template strand reads 3' TACGGATCCAAAATT 5'. Find the protein.

1. Pair each base to get the mRNA: AUGCCUAGGUUUUAA.
2. Split it into codons: AUG CCU AGG UUU UAA.
3. Look each one up on the chart: AUG is Met (start), CCU is Pro, AGG is Arg, UUU is Phe and UAA is stop.

The protein is Met-Pro-Arg-Phe, four amino acids from five codons. To check it, paste TACGGATCCAAAATT into the DNA Translator and set This strand is the to Template strand, 3' to 5'.

How to use the DNA Translator

1. Open the calculator with the button near the top. It starts on the beginning of the human beta-globin gene (HBB).
2. Paste or type your sequence in the Sequence section. Spaces, numbers and FASTA header lines are ignored, and if you paste RNA, U is read as T. It takes up to 3,000 bases.
3. Under This strand is the, choose the coding strand 5' to 3', the template strand 3' to 5', or the template strand 5' to 3'.
4. Under Reading frame, leave First AUG to read like a ribosome, or pick frame 1, 2 or 3 yourself. Stop at the first stop codon is on by default.
5. Read the results: the protein as a chain of amino acids coloured by chemical family, each codon lined up under the coding strand, template strand and mRNA, and the codon chart with every codon used filled in.

The readouts also give the number of bases, the GC content, the reading frame in use, the number of amino acids, and the longest open reading frame in each of the three frames. The Example menu loads beta-globin, the sickle-cell version, the insulin signal peptide and a sequence with two reading frames. For practice, Practice and help sets codon, transcription, counting and mutation questions with hints and worked solutions.

Example: the start of beta-globin

The starting sequence is ACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGTAA, the first codons of beta-globin with a stop codon added so the example ends. The first AUG begins at base 6, so the calculator reads in frame 3 and greys out the first five bases. The codons from AUG to UAA give an 18 amino acid chain:

Met-Val-His-Leu-Thr-Pro-Glu-Glu-Lys-Ser-Ala-Val-Thr-Ala-Leu-Trp-Gly-Lys

Check a few on the chart yourself: GUG is Val, CAC is His and UGG is Trp. Then try translating a short mRNA here, and press Mark to check it in our Genetics and DNA course.

Using the codon chart to work out mutations

A codon chart shows what a mutation does to a protein: translate the codon before and after the change and compare. In the DNA Translator, open Mutation, choose Point, Insert or Delete, and give the base number on the coding strand. It shows the protein before and after and names the effect. All of these use the beta-globin start sequence.

The base 25 change is the mutation behind sickle cell anaemia (anemia in the US), which the Example menu loads as the sickle-cell sequence. The first of the two glutamic acids becomes valine. MedlinePlus writes it as Glu6Val, because beta-globin is numbered without its starting methionine.

An insertion or a deletion of one base shifts the reading frame, so every codon after it changes. That is why frameshifts usually do more damage than a single swapped amino acid. Try naming one:

Common mistakes

• Looking up DNA on an mRNA chart. Convert to mRNA first. A template strand base of A becomes U, not T.
• Looking up the template strand directly. The template is the complement of the mRNA. Only the coding strand matches it, with T for U.
• Starting at the first base. Translation starts at AUG. Bases before it are not read, and starting in the wrong place gives the wrong frame.
• Adding an amino acid for the stop codon. UAA, UAG and UGA end the chain and add nothing.
• Mixing up the axes. First base down the side, second along the top, third inside the box. Reading the second base down the side gives a different amino acid.
• Reading an anticodon as a codon. A tRNA anticodon pairs with the codon. Convert it to the codon before you use the chart.

Practise in a short timed paper

Transcription, translation and mutations come up in High School Biology and AP Biology practice, and in GCSE Biology Higher in the UK. Each daily paper is a short timed paper of 8 questions worth 25 to 35 marks. The papers mix topics, so codons will not come up in every one.

Read next

Biology · Genetics and inheritanceWhat does DNA stand for? DNA meaning, structure and functionDNA stands for deoxyribonucleic acid. Learn what DNA is made of, the sugar in it, what it does, who discovered it and why it matters, with examples.